1/* 2 ********************************************************************** 3 * Copyright (C) 2005-2013, International Business Machines 4 * Corporation and others. All Rights Reserved. 5 ********************************************************************** 6 */ 7 8#include "unicode/utypes.h" 9 10#if !UCONFIG_NO_COLLATION 11 12#include "cmemory.h" 13#include "cstring.h" 14#include "ucol_imp.h" 15 16#include "unicode/coll.h" 17#include "unicode/tblcoll.h" 18#include "unicode/usearch.h" 19#include "unicode/uset.h" 20#include "unicode/ustring.h" 21 22#include "unicode/coleitr.h" 23#include "unicode/regex.h" // TODO: make conditional on regexp being built. 24 25#include "colldata.h" 26#include "ssearch.h" 27#include "xmlparser.h" 28 29#include <stdio.h> // for sprintf 30 31char testId[100]; 32 33#define TEST_ASSERT(x) {if (!(x)) { \ 34 errln("Failure in file %s, line %d, test ID = \"%s\"", __FILE__, __LINE__, testId);}} 35 36#define TEST_ASSERT_M(x, m) {if (!(x)) { \ 37 dataerrln("Failure in file %s, line %d. \"%s\"", __FILE__, __LINE__, m);return;}} 38 39#define TEST_ASSERT_SUCCESS(errcode) {if (U_FAILURE(errcode)) { \ 40 dataerrln("Failure in file %s, line %d, test ID \"%s\", status = \"%s\"", \ 41 __FILE__, __LINE__, testId, u_errorName(errcode));}} 42 43#define ARRAY_SIZE(array) (sizeof array / sizeof array[0]) 44#define NEW_ARRAY(type, count) (type *) uprv_malloc((count) * sizeof(type)) 45#define DELETE_ARRAY(array) uprv_free((void *) (array)) 46 47//--------------------------------------------------------------------------- 48// 49// Test class boilerplate 50// 51//--------------------------------------------------------------------------- 52SSearchTest::SSearchTest() 53{ 54} 55 56SSearchTest::~SSearchTest() 57{ 58} 59 60void SSearchTest::runIndexedTest( int32_t index, UBool exec, const char* &name, char *params ) 61{ 62 if (exec) logln("TestSuite SSearchTest: "); 63 switch (index) { 64#if !UCONFIG_NO_BREAK_ITERATION 65 case 0: name = "searchTest"; 66 if (exec) searchTest(); 67 break; 68 69 case 1: name = "offsetTest"; 70 if (exec) offsetTest(); 71 break; 72 73 case 2: name = "monkeyTest"; 74 if (exec) monkeyTest(params); 75 break; 76 77 case 3: name = "sharpSTest"; 78 if (exec) sharpSTest(); 79 break; 80 81 case 4: name = "goodSuffixTest"; 82 if (exec) goodSuffixTest(); 83 break; 84 85 case 5: name = "searchTime"; 86 if (exec) searchTime(); 87 break; 88#endif 89 default: name = ""; 90 break; //needed to end loop 91 } 92} 93 94 95#if !UCONFIG_NO_BREAK_ITERATION 96 97#define PATH_BUFFER_SIZE 2048 98const char *SSearchTest::getPath(char buffer[2048], const char *filename) { 99 UErrorCode status = U_ZERO_ERROR; 100 const char *testDataDirectory = IntlTest::getSourceTestData(status); 101 102 if (U_FAILURE(status) || strlen(testDataDirectory) + strlen(filename) + 1 >= PATH_BUFFER_SIZE) { 103 errln("ERROR: getPath() failed - %s", u_errorName(status)); 104 return NULL; 105 } 106 107 strcpy(buffer, testDataDirectory); 108 strcat(buffer, filename); 109 return buffer; 110} 111 112 113void SSearchTest::searchTest() 114{ 115#if !UCONFIG_NO_REGULAR_EXPRESSIONS && !UCONFIG_NO_FILE_IO 116 UErrorCode status = U_ZERO_ERROR; 117 char path[PATH_BUFFER_SIZE]; 118 const char *testFilePath = getPath(path, "ssearch.xml"); 119 120 if (testFilePath == NULL) { 121 return; /* Couldn't get path: error message already output. */ 122 } 123 124 LocalPointer<UXMLParser> parser(UXMLParser::createParser(status)); 125 TEST_ASSERT_SUCCESS(status); 126 LocalPointer<UXMLElement> root(parser->parseFile(testFilePath, status)); 127 TEST_ASSERT_SUCCESS(status); 128 if (U_FAILURE(status)) { 129 return; 130 } 131 132 const UnicodeString *debugTestCase = root->getAttribute("debug"); 133 if (debugTestCase != NULL) { 134// setenv("USEARCH_DEBUG", "1", 1); 135 } 136 137 138 const UXMLElement *testCase; 139 int32_t tc = 0; 140 141 while((testCase = root->nextChildElement(tc)) != NULL) { 142 143 if (testCase->getTagName().compare("test-case") != 0) { 144 errln("ssearch, unrecognized XML Element in test file"); 145 continue; 146 } 147 const UnicodeString *id = testCase->getAttribute("id"); 148 *testId = 0; 149 if (id != NULL) { 150 id->extract(0, id->length(), testId, sizeof(testId), US_INV); 151 } 152 153 // If debugging test case has been specified and this is not it, skip to next. 154 if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) { 155 continue; 156 } 157 // 158 // Get the requested collation strength. 159 // Default is tertiary if the XML attribute is missing from the test case. 160 // 161 const UnicodeString *strength = testCase->getAttribute("strength"); 162 UColAttributeValue collatorStrength = UCOL_PRIMARY; 163 if (strength==NULL) { collatorStrength = UCOL_TERTIARY;} 164 else if (*strength=="PRIMARY") { collatorStrength = UCOL_PRIMARY;} 165 else if (*strength=="SECONDARY") { collatorStrength = UCOL_SECONDARY;} 166 else if (*strength=="TERTIARY") { collatorStrength = UCOL_TERTIARY;} 167 else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;} 168 else if (*strength=="IDENTICAL") { collatorStrength = UCOL_IDENTICAL;} 169 else { 170 // Bogus value supplied for strength. Shouldn't happen, even from 171 // typos, if the XML source has been validated. 172 // This assert is a little deceiving in that strength can be 173 // any of the allowed values, not just TERTIARY, but it will 174 // do the job of getting the error output. 175 TEST_ASSERT(*strength=="TERTIARY") 176 } 177 178 // 179 // Get the collator normalization flag. Default is UCOL_OFF. 180 // 181 UColAttributeValue normalize = UCOL_OFF; 182 const UnicodeString *norm = testCase->getAttribute("norm"); 183 TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF"); 184 if (norm!=NULL && *norm=="ON") { 185 normalize = UCOL_ON; 186 } 187 188 // 189 // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE. 190 // 191 UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE; 192 const UnicodeString *alt = testCase->getAttribute("alternate_handling"); 193 TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE"); 194 if (alt != NULL && *alt == "SHIFTED") { 195 alternateHandling = UCOL_SHIFTED; 196 } 197 198 const UnicodeString defLocale("en"); 199 char clocale[100]; 200 const UnicodeString *locale = testCase->getAttribute("locale"); 201 if (locale == NULL || locale->length()==0) { 202 locale = &defLocale; 203 }; 204 locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL); 205 206 207 UnicodeString text; 208 UnicodeString target; 209 UnicodeString pattern; 210 int32_t expectedMatchStart = -1; 211 int32_t expectedMatchLimit = -1; 212 const UXMLElement *n; 213 int32_t nodeCount = 0; 214 215 n = testCase->getChildElement("pattern"); 216 TEST_ASSERT(n != NULL); 217 if (n==NULL) { 218 continue; 219 } 220 text = n->getText(FALSE); 221 text = text.unescape(); 222 pattern.append(text); 223 nodeCount++; 224 225 n = testCase->getChildElement("pre"); 226 if (n!=NULL) { 227 text = n->getText(FALSE); 228 text = text.unescape(); 229 target.append(text); 230 nodeCount++; 231 } 232 233 n = testCase->getChildElement("m"); 234 if (n!=NULL) { 235 expectedMatchStart = target.length(); 236 text = n->getText(FALSE); 237 text = text.unescape(); 238 target.append(text); 239 expectedMatchLimit = target.length(); 240 nodeCount++; 241 } 242 243 n = testCase->getChildElement("post"); 244 if (n!=NULL) { 245 text = n->getText(FALSE); 246 text = text.unescape(); 247 target.append(text); 248 nodeCount++; 249 } 250 251 // Check that there weren't extra things in the XML 252 TEST_ASSERT(nodeCount == testCase->countChildren()); 253 254 // Open a collator and StringSearch based on the parameters 255 // obtained from the XML. 256 // 257 status = U_ZERO_ERROR; 258 LocalUCollatorPointer collator(ucol_open(clocale, &status)); 259 ucol_setStrength(collator.getAlias(), collatorStrength); 260 ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status); 261 ucol_setAttribute(collator.getAlias(), UCOL_ALTERNATE_HANDLING, alternateHandling, &status); 262 LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), 263 target.getBuffer(), target.length(), 264 collator.getAlias(), 265 NULL, // the break iterator 266 &status)); 267 268 TEST_ASSERT_SUCCESS(status); 269 if (U_FAILURE(status)) { 270 continue; 271 } 272 273 int32_t foundStart = 0; 274 int32_t foundLimit = 0; 275 UBool foundMatch; 276 277 // 278 // Do the search, check the match result against the expected results. 279 // 280 foundMatch= usearch_search(uss.getAlias(), 0, &foundStart, &foundLimit, &status); 281 TEST_ASSERT_SUCCESS(status); 282 if ((foundMatch && expectedMatchStart<0) || 283 (foundStart != expectedMatchStart) || 284 (foundLimit != expectedMatchLimit)) { 285 TEST_ASSERT(FALSE); // ouput generic error position 286 infoln("Found, expected match start = %d, %d \n" 287 "Found, expected match limit = %d, %d", 288 foundStart, expectedMatchStart, foundLimit, expectedMatchLimit); 289 } 290 291 // In case there are other matches... 292 // (should we only do this if the test case passed?) 293 while (foundMatch) { 294 expectedMatchStart = foundStart; 295 expectedMatchLimit = foundLimit; 296 297 foundMatch = usearch_search(uss.getAlias(), foundLimit, &foundStart, &foundLimit, &status); 298 } 299 300 uss.adoptInstead(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), 301 target.getBuffer(), target.length(), 302 collator.getAlias(), 303 NULL, 304 &status)); 305 306 // 307 // Do the backwards search, check the match result against the expected results. 308 // 309 foundMatch= usearch_searchBackwards(uss.getAlias(), target.length(), &foundStart, &foundLimit, &status); 310 TEST_ASSERT_SUCCESS(status); 311 if ((foundMatch && expectedMatchStart<0) || 312 (foundStart != expectedMatchStart) || 313 (foundLimit != expectedMatchLimit)) { 314 TEST_ASSERT(FALSE); // ouput generic error position 315 infoln("Found, expected backwards match start = %d, %d \n" 316 "Found, expected backwards match limit = %d, %d", 317 foundStart, expectedMatchStart, foundLimit, expectedMatchLimit); 318 } 319 } 320#endif 321} 322 323struct Order 324{ 325 int32_t order; 326 int32_t lowOffset; 327 int32_t highOffset; 328}; 329 330class OrderList 331{ 332public: 333 OrderList(); 334 OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset = 0); 335 ~OrderList(); 336 337 int32_t size(void) const; 338 void add(int32_t order, int32_t low, int32_t high); 339 const Order *get(int32_t index) const; 340 int32_t getLowOffset(int32_t index) const; 341 int32_t getHighOffset(int32_t index) const; 342 int32_t getOrder(int32_t index) const; 343 void reverse(void); 344 UBool compare(const OrderList &other) const; 345 UBool matchesAt(int32_t offset, const OrderList &other) const; 346 347private: 348 Order *list; 349 int32_t listMax; 350 int32_t listSize; 351}; 352 353OrderList::OrderList() 354 : list(NULL), listMax(16), listSize(0) 355{ 356 list = new Order[listMax]; 357} 358 359OrderList::OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset) 360 : list(NULL), listMax(16), listSize(0) 361{ 362 UErrorCode status = U_ZERO_ERROR; 363 UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status); 364 uint32_t strengthMask = 0; 365 int32_t order, low, high; 366 367 switch (ucol_getStrength(coll)) 368 { 369 default: 370 strengthMask |= UCOL_TERTIARYORDERMASK; 371 /* fall through */ 372 373 case UCOL_SECONDARY: 374 strengthMask |= UCOL_SECONDARYORDERMASK; 375 /* fall through */ 376 377 case UCOL_PRIMARY: 378 strengthMask |= UCOL_PRIMARYORDERMASK; 379 } 380 381 list = new Order[listMax]; 382 383 ucol_setOffset(elems, stringOffset, &status); 384 385 do { 386 low = ucol_getOffset(elems); 387 order = ucol_next(elems, &status); 388 high = ucol_getOffset(elems); 389 390 if (order != UCOL_NULLORDER) { 391 order &= strengthMask; 392 } 393 394 if (order != UCOL_IGNORABLE) { 395 add(order, low, high); 396 } 397 } while (order != UCOL_NULLORDER); 398 399 ucol_closeElements(elems); 400} 401 402OrderList::~OrderList() 403{ 404 delete[] list; 405} 406 407void OrderList::add(int32_t order, int32_t low, int32_t high) 408{ 409 if (listSize >= listMax) { 410 listMax *= 2; 411 412 Order *newList = new Order[listMax]; 413 414 uprv_memcpy(newList, list, listSize * sizeof(Order)); 415 delete[] list; 416 list = newList; 417 } 418 419 list[listSize].order = order; 420 list[listSize].lowOffset = low; 421 list[listSize].highOffset = high; 422 423 listSize += 1; 424} 425 426const Order *OrderList::get(int32_t index) const 427{ 428 if (index >= listSize) { 429 return NULL; 430 } 431 432 return &list[index]; 433} 434 435int32_t OrderList::getLowOffset(int32_t index) const 436{ 437 const Order *order = get(index); 438 439 if (order != NULL) { 440 return order->lowOffset; 441 } 442 443 return -1; 444} 445 446int32_t OrderList::getHighOffset(int32_t index) const 447{ 448 const Order *order = get(index); 449 450 if (order != NULL) { 451 return order->highOffset; 452 } 453 454 return -1; 455} 456 457int32_t OrderList::getOrder(int32_t index) const 458{ 459 const Order *order = get(index); 460 461 if (order != NULL) { 462 return order->order; 463 } 464 465 return UCOL_NULLORDER; 466} 467 468int32_t OrderList::size() const 469{ 470 return listSize; 471} 472 473void OrderList::reverse() 474{ 475 for(int32_t f = 0, b = listSize - 1; f < b; f += 1, b -= 1) { 476 Order swap = list[b]; 477 478 list[b] = list[f]; 479 list[f] = swap; 480 } 481} 482 483UBool OrderList::compare(const OrderList &other) const 484{ 485 if (listSize != other.listSize) { 486 return FALSE; 487 } 488 489 for(int32_t i = 0; i < listSize; i += 1) { 490 if (list[i].order != other.list[i].order || 491 list[i].lowOffset != other.list[i].lowOffset || 492 list[i].highOffset != other.list[i].highOffset) { 493 return FALSE; 494 } 495 } 496 497 return TRUE; 498} 499 500UBool OrderList::matchesAt(int32_t offset, const OrderList &other) const 501{ 502 // NOTE: sizes include the NULLORDER, which we don't want to compare. 503 int32_t otherSize = other.size() - 1; 504 505 if (listSize - 1 - offset < otherSize) { 506 return FALSE; 507 } 508 509 for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) { 510 if (getOrder(i) != other.getOrder(j)) { 511 return FALSE; 512 } 513 } 514 515 return TRUE; 516} 517 518static char *printOffsets(char *buffer, OrderList &list) 519{ 520 int32_t size = list.size(); 521 char *s = buffer; 522 523 for(int32_t i = 0; i < size; i += 1) { 524 const Order *order = list.get(i); 525 526 if (i != 0) { 527 s += sprintf(s, ", "); 528 } 529 530 s += sprintf(s, "(%d, %d)", order->lowOffset, order->highOffset); 531 } 532 533 return buffer; 534} 535 536static char *printOrders(char *buffer, OrderList &list) 537{ 538 int32_t size = list.size(); 539 char *s = buffer; 540 541 for(int32_t i = 0; i < size; i += 1) { 542 const Order *order = list.get(i); 543 544 if (i != 0) { 545 s += sprintf(s, ", "); 546 } 547 548 s += sprintf(s, "%8.8X", order->order); 549 } 550 551 return buffer; 552} 553 554void SSearchTest::offsetTest() 555{ 556 const char *test[] = { 557 // The sequence \u0FB3\u0F71\u0F71\u0F80 contains a discontiguous 558 // contraction (\u0FB3\u0F71\u0F80) logically followed by \u0F71. 559 "\\u1E33\\u0FB3\\u0F71\\u0F71\\u0F80\\uD835\\uDF6C\\u01B0", 560 561 "\\ua191\\u16ef\\u2036\\u017a", 562 563#if 0 564 // This results in a complex interaction between contraction, 565 // expansion and normalization that confuses the backwards offset fixups. 566 "\\u0F7F\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85", 567#endif 568 569 "\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85", 570 "\\u07E9\\u07EA\\u07F1\\u07F2\\u07F3", 571 572 "\\u02FE\\u02FF" 573 "\\u0300\\u0301\\u0302\\u0303\\u0304\\u0305\\u0306\\u0307\\u0308\\u0309\\u030A\\u030B\\u030C\\u030D\\u030E\\u030F" 574 "\\u0310\\u0311\\u0312\\u0313\\u0314\\u0315\\u0316\\u0317\\u0318\\u0319\\u031A\\u031B\\u031C\\u031D\\u031E\\u031F" 575 "\\u0320\\u0321\\u0322\\u0323\\u0324\\u0325\\u0326\\u0327\\u0328\\u0329\\u032A\\u032B\\u032C\\u032D\\u032E\\u032F" 576 "\\u0330\\u0331\\u0332\\u0333\\u0334\\u0335\\u0336\\u0337\\u0338\\u0339\\u033A\\u033B\\u033C\\u033D\\u033E\\u033F" 577 "\\u0340\\u0341\\u0342\\u0343\\u0344\\u0345\\u0346\\u0347\\u0348\\u0349\\u034A\\u034B\\u034C\\u034D\\u034E", // currently not working, see #8081 578 579 "\\u02FE\\u02FF\\u0300\\u0301\\u0302\\u0303\\u0316\\u0317\\u0318", // currently not working, see #8081 580 "a\\u02FF\\u0301\\u0316", // currently not working, see #8081 581 "a\\u02FF\\u0316\\u0301", 582 "a\\u0430\\u0301\\u0316", 583 "a\\u0430\\u0316\\u0301", 584 "abc\\u0E41\\u0301\\u0316", 585 "abc\\u0E41\\u0316\\u0301", 586 "\\u0E41\\u0301\\u0316", 587 "\\u0E41\\u0316\\u0301", 588 "a\\u0301\\u0316", 589 "a\\u0316\\u0301", 590 "\\uAC52\\uAC53", 591 "\\u34CA\\u34CB", 592 "\\u11ED\\u11EE", 593 "\\u30C3\\u30D0", 594 "p\\u00E9ch\\u00E9", 595 "a\\u0301\\u0325", 596 "a\\u0300\\u0325", 597 "a\\u0325\\u0300", 598 "A\\u0323\\u0300B", 599 "A\\u0300\\u0323B", 600 "A\\u0301\\u0323B", 601 "A\\u0302\\u0301\\u0323B", 602 "abc", 603 "ab\\u0300c", 604 "ab\\u0300\\u0323c", 605 " \\uD800\\uDC00\\uDC00", 606 "a\\uD800\\uDC00\\uDC00", 607 "A\\u0301\\u0301", 608 "A\\u0301\\u0323", 609 "A\\u0301\\u0323B", 610 "B\\u0301\\u0323C", 611 "A\\u0300\\u0323B", 612 "\\u0301A\\u0301\\u0301", 613 "abcd\\r\\u0301", 614 "p\\u00EAche", 615 "pe\\u0302che", 616 }; 617 618 int32_t testCount = ARRAY_SIZE(test); 619 UErrorCode status = U_ZERO_ERROR; 620 RuleBasedCollator *col = (RuleBasedCollator *) Collator::createInstance(Locale::getEnglish(), status); 621 if (U_FAILURE(status)) { 622 errcheckln(status, "Failed to create collator in offsetTest! - %s", u_errorName(status)); 623 return; 624 } 625 char buffer[4096]; // A bit of a hack... just happens to be long enough for all the test cases... 626 // We could allocate one that's the right size by (CE_count * 10) + 2 627 // 10 chars is enough room for 8 hex digits plus ", ". 2 extra chars for "[" and "]" 628 629 col->setAttribute(UCOL_NORMALIZATION_MODE, UCOL_ON, status); 630 631 for(int32_t i = 0; i < testCount; i += 1) { 632 if (!isICUVersionAtLeast(52, 0, 1) && i>=4 && i<=6) { 633 continue; // timebomb until ticket #9156 (was #8081) is resolved 634 } 635 UnicodeString ts = CharsToUnicodeString(test[i]); 636 CollationElementIterator *iter = col->createCollationElementIterator(ts); 637 OrderList forwardList; 638 OrderList backwardList; 639 int32_t order, low, high; 640 641 do { 642 low = iter->getOffset(); 643 order = iter->next(status); 644 high = iter->getOffset(); 645 646 forwardList.add(order, low, high); 647 } while (order != CollationElementIterator::NULLORDER); 648 649 iter->reset(); 650 iter->setOffset(ts.length(), status); 651 652 backwardList.add(CollationElementIterator::NULLORDER, iter->getOffset(), iter->getOffset()); 653 654 do { 655 high = iter->getOffset(); 656 order = iter->previous(status); 657 low = iter->getOffset(); 658 659 if (order == CollationElementIterator::NULLORDER) { 660 break; 661 } 662 663 backwardList.add(order, low, high); 664 } while (TRUE); 665 666 backwardList.reverse(); 667 668 if (forwardList.compare(backwardList)) { 669 logln("Works with \"%s\"", test[i]); 670 logln("Forward offsets: [%s]", printOffsets(buffer, forwardList)); 671// logln("Backward offsets: [%s]", printOffsets(buffer, backwardList)); 672 673 logln("Forward CEs: [%s]", printOrders(buffer, forwardList)); 674// logln("Backward CEs: [%s]", printOrders(buffer, backwardList)); 675 676 logln(); 677 } else { 678 errln("Fails with \"%s\"", test[i]); 679 infoln("Forward offsets: [%s]", printOffsets(buffer, forwardList)); 680 infoln("Backward offsets: [%s]", printOffsets(buffer, backwardList)); 681 682 infoln("Forward CEs: [%s]", printOrders(buffer, forwardList)); 683 infoln("Backward CEs: [%s]", printOrders(buffer, backwardList)); 684 685 infoln(); 686 } 687 delete iter; 688 } 689 delete col; 690} 691 692#if 0 693static UnicodeString &escape(const UnicodeString &string, UnicodeString &buffer) 694{ 695 for(int32_t i = 0; i < string.length(); i += 1) { 696 UChar32 ch = string.char32At(i); 697 698 if (ch >= 0x0020 && ch <= 0x007F) { 699 if (ch == 0x005C) { 700 buffer.append("\\\\"); 701 } else { 702 buffer.append(ch); 703 } 704 } else { 705 char cbuffer[12]; 706 707 if (ch <= 0xFFFFL) { 708 sprintf(cbuffer, "\\u%4.4X", ch); 709 } else { 710 sprintf(cbuffer, "\\U%8.8X", ch); 711 } 712 713 buffer.append(cbuffer); 714 } 715 716 if (ch >= 0x10000L) { 717 i += 1; 718 } 719 } 720 721 return buffer; 722} 723#endif 724 725void SSearchTest::sharpSTest() 726{ 727 UErrorCode status = U_ZERO_ERROR; 728 UCollator *coll = NULL; 729 UnicodeString lp = "fuss"; 730 UnicodeString sp = "fu\\u00DF"; 731 UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball", 732 "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF", 733 "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"}; 734 int32_t start = -1, end = -1; 735 736 coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status); 737 TEST_ASSERT_SUCCESS(status); 738 739 UnicodeString lpUnescaped = lp.unescape(); 740 UnicodeString spUnescaped = sp.unescape(); 741 742 LocalUStringSearchPointer ussLong(usearch_openFromCollator(lpUnescaped.getBuffer(), lpUnescaped.length(), 743 lpUnescaped.getBuffer(), lpUnescaped.length(), // actual test data will be set later 744 coll, 745 NULL, // the break iterator 746 &status)); 747 748 LocalUStringSearchPointer ussShort(usearch_openFromCollator(spUnescaped.getBuffer(), spUnescaped.length(), 749 spUnescaped.getBuffer(), spUnescaped.length(), // actual test data will be set later 750 coll, 751 NULL, // the break iterator 752 &status)); 753 TEST_ASSERT_SUCCESS(status); 754 755 for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) { 756 UBool bFound; 757 UnicodeString target = targets[t].unescape(); 758 759 start = end = -1; 760 usearch_setText(ussLong.getAlias(), target.getBuffer(), target.length(), &status); 761 bFound = usearch_search(ussLong.getAlias(), 0, &start, &end, &status); 762 TEST_ASSERT_SUCCESS(status); 763 if (bFound) { 764 logln("Test %d: found long pattern at [%d, %d].", t, start, end); 765 } else { 766 dataerrln("Test %d: did not find long pattern.", t); 767 } 768 769 usearch_setText(ussShort.getAlias(), target.getBuffer(), target.length(), &status); 770 bFound = usearch_search(ussShort.getAlias(), 0, &start, &end, &status); 771 TEST_ASSERT_SUCCESS(status); 772 if (bFound) { 773 logln("Test %d: found long pattern at [%d, %d].", t, start, end); 774 } else { 775 dataerrln("Test %d: did not find long pattern.", t); 776 } 777 } 778 779 ucol_close(coll); 780} 781 782void SSearchTest::goodSuffixTest() 783{ 784 UErrorCode status = U_ZERO_ERROR; 785 UCollator *coll = NULL; 786 UnicodeString pat = /*"gcagagag"*/ "fxeld"; 787 UnicodeString target = /*"gcatcgcagagagtatacagtacg"*/ "cloveldfxeld"; 788 int32_t start = -1, end = -1; 789 UBool bFound; 790 791 coll = ucol_open(NULL, &status); 792 TEST_ASSERT_SUCCESS(status); 793 794 LocalUStringSearchPointer ss(usearch_openFromCollator(pat.getBuffer(), pat.length(), 795 target.getBuffer(), target.length(), 796 coll, 797 NULL, // the break iterator 798 &status)); 799 TEST_ASSERT_SUCCESS(status); 800 801 bFound = usearch_search(ss.getAlias(), 0, &start, &end, &status); 802 TEST_ASSERT_SUCCESS(status); 803 if (bFound) { 804 logln("Found pattern at [%d, %d].", start, end); 805 } else { 806 dataerrln("Did not find pattern."); 807 } 808 809 ucol_close(coll); 810} 811 812// 813// searchTime() A quick and dirty performance test for string search. 814// Probably doesn't really belong as part of intltest, but it 815// does check that the search succeeds, and gets the right result, 816// so it serves as a functionality test also. 817// 818// To run as a perf test, up the loop count, select by commenting 819// and uncommenting in the code the operation to be measured, 820// rebuild, and measure the running time of this test alone. 821// 822// time LD_LIBRARY_PATH=whatever ./intltest collate/SSearchTest/searchTime 823// 824void SSearchTest::searchTime() { 825 static const char *longishText = 826"Whylom, as olde stories tellen us,\n" 827"Ther was a duk that highte Theseus:\n" 828"Of Athenes he was lord and governour,\n" 829"And in his tyme swich a conquerour,\n" 830"That gretter was ther noon under the sonne.\n" 831"Ful many a riche contree hadde he wonne;\n" 832"What with his wisdom and his chivalrye,\n" 833"He conquered al the regne of Femenye,\n" 834"That whylom was y-cleped Scithia;\n" 835"And weddede the quene Ipolita,\n" 836"And broghte hir hoom with him in his contree\n" 837"With muchel glorie and greet solempnitee,\n" 838"And eek hir yonge suster Emelye.\n" 839"And thus with victorie and with melodye\n" 840"Lete I this noble duk to Athenes ryde,\n" 841"And al his hoost, in armes, him bisyde.\n" 842"And certes, if it nere to long to here,\n" 843"I wolde han told yow fully the manere,\n" 844"How wonnen was the regne of Femenye\n" 845"By Theseus, and by his chivalrye;\n" 846"And of the grete bataille for the nones\n" 847"Bitwixen Athen's and Amazones;\n" 848"And how asseged was Ipolita,\n" 849"The faire hardy quene of Scithia;\n" 850"And of the feste that was at hir weddinge,\n" 851"And of the tempest at hir hoom-cominge;\n" 852"But al that thing I moot as now forbere.\n" 853"I have, God woot, a large feeld to ere,\n" 854"And wayke been the oxen in my plough.\n" 855"The remenant of the tale is long y-nough.\n" 856"I wol nat letten eek noon of this route;\n" 857"Lat every felawe telle his tale aboute,\n" 858"And lat see now who shal the soper winne;\n" 859"And ther I lefte, I wol ageyn biginne.\n" 860"This duk, of whom I make mencioun,\n" 861"When he was come almost unto the toun,\n" 862"In al his wele and in his moste pryde,\n" 863"He was war, as he caste his eye asyde,\n" 864"Wher that ther kneled in the hye weye\n" 865"A companye of ladies, tweye and tweye,\n" 866"Ech after other, clad in clothes blake; \n" 867"But swich a cry and swich a wo they make,\n" 868"That in this world nis creature livinge,\n" 869"That herde swich another weymentinge;\n" 870"And of this cry they nolde never stenten,\n" 871"Til they the reynes of his brydel henten.\n" 872"'What folk ben ye, that at myn hoomcominge\n" 873"Perturben so my feste with cryinge'?\n" 874"Quod Theseus, 'have ye so greet envye\n" 875"Of myn honour, that thus compleyne and crye? \n" 876"Or who hath yow misboden, or offended?\n" 877"And telleth me if it may been amended;\n" 878"And why that ye ben clothed thus in blak'?\n" 879"The eldest lady of hem alle spak,\n" 880"When she hadde swowned with a deedly chere,\n" 881"That it was routhe for to seen and here,\n" 882"And seyde: 'Lord, to whom Fortune hath yiven\n" 883"Victorie, and as a conquerour to liven,\n" 884"Noght greveth us your glorie and your honour;\n" 885"But we biseken mercy and socour.\n" 886"Have mercy on our wo and our distresse.\n" 887"Som drope of pitee, thurgh thy gentilesse,\n" 888"Up-on us wrecched wommen lat thou falle.\n" 889"For certes, lord, ther nis noon of us alle,\n" 890"That she nath been a duchesse or a quene;\n" 891"Now be we caitifs, as it is wel sene:\n" 892"Thanked be Fortune, and hir false wheel,\n" 893"That noon estat assureth to be weel.\n" 894"And certes, lord, t'abyden your presence,\n" 895"Here in the temple of the goddesse Clemence\n" 896"We han ben waytinge al this fourtenight;\n" 897"Now help us, lord, sith it is in thy might.\n" 898"I wrecche, which that wepe and waille thus,\n" 899"Was whylom wyf to king Capaneus,\n" 900"That starf at Thebes, cursed be that day!\n" 901"And alle we, that been in this array,\n" 902"And maken al this lamentacioun,\n" 903"We losten alle our housbondes at that toun,\n" 904"Whyl that the sege ther-aboute lay.\n" 905"And yet now th'olde Creon, weylaway!\n" 906"The lord is now of Thebes the citee, \n" 907"Fulfild of ire and of iniquitee,\n" 908"He, for despyt, and for his tirannye,\n" 909"To do the dede bodyes vileinye,\n" 910"Of alle our lordes, whiche that ben slawe,\n" 911"Hath alle the bodyes on an heep y-drawe,\n" 912"And wol nat suffren hem, by noon assent,\n" 913"Neither to been y-buried nor y-brent,\n" 914"But maketh houndes ete hem in despyt. zet'\n"; 915 916const char *cPattern = "maketh houndes ete hem"; 917//const char *cPattern = "Whylom"; 918//const char *cPattern = "zet"; 919 const char *testId = "searchTime()"; // for error macros. 920 UnicodeString target = longishText; 921 UErrorCode status = U_ZERO_ERROR; 922 923 924 LocalUCollatorPointer collator(ucol_open("en", &status)); 925 //ucol_setStrength(collator.getAlias(), collatorStrength); 926 //ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status); 927 UnicodeString uPattern = cPattern; 928 LocalUStringSearchPointer uss(usearch_openFromCollator(uPattern.getBuffer(), uPattern.length(), 929 target.getBuffer(), target.length(), 930 collator.getAlias(), 931 NULL, // the break iterator 932 &status)); 933 TEST_ASSERT_SUCCESS(status); 934 935// int32_t foundStart; 936// int32_t foundEnd; 937 UBool found; 938 939 // Find the match position usgin strstr 940 const char *pm = strstr(longishText, cPattern); 941 TEST_ASSERT_M(pm!=NULL, "No pattern match with strstr"); 942 int32_t refMatchPos = (int32_t)(pm - longishText); 943 int32_t icuMatchPos; 944 int32_t icuMatchEnd; 945 usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status); 946 TEST_ASSERT_SUCCESS(status); 947 TEST_ASSERT_M(refMatchPos == icuMatchPos, "strstr and icu give different match positions."); 948 949 int32_t i; 950 // int32_t j=0; 951 952 // Try loopcounts around 100000 to some millions, depending on the operation, 953 // to get runtimes of at least several seconds. 954 for (i=0; i<10000; i++) { 955 found = usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status); 956 //TEST_ASSERT_SUCCESS(status); 957 //TEST_ASSERT(found); 958 959 // usearch_setOffset(uss.getAlias(), 0, &status); 960 // icuMatchPos = usearch_next(uss.getAlias(), &status); 961 962 // The i+j stuff is to confuse the optimizer and get it to actually leave the 963 // call to strstr in place. 964 //pm = strstr(longishText+j, cPattern); 965 //j = (j + i)%5; 966 } 967 968 //printf("%ld, %d\n", pm-longishText, j); 969} 970 971//---------------------------------------------------------------------------------------- 972// 973// Random Numbers. Similar to standard lib rand() and srand() 974// Not using library to 975// 1. Get same results on all platforms. 976// 2. Get access to current seed, to more easily reproduce failures. 977// 978//--------------------------------------------------------------------------------------- 979static uint32_t m_seed = 1; 980 981static uint32_t m_rand() 982{ 983 m_seed = m_seed * 1103515245 + 12345; 984 return (uint32_t)(m_seed/65536) % 32768; 985} 986 987class Monkey 988{ 989public: 990 virtual void append(UnicodeString &test, UnicodeString &alternate) = 0; 991 992protected: 993 Monkey(); 994 virtual ~Monkey(); 995}; 996 997Monkey::Monkey() 998{ 999 // ook? 1000} 1001 1002Monkey::~Monkey() 1003{ 1004 // ook? 1005} 1006 1007class SetMonkey : public Monkey 1008{ 1009public: 1010 SetMonkey(const USet *theSet); 1011 ~SetMonkey(); 1012 1013 virtual void append(UnicodeString &test, UnicodeString &alternate); 1014 1015private: 1016 const USet *set; 1017}; 1018 1019SetMonkey::SetMonkey(const USet *theSet) 1020 : Monkey(), set(theSet) 1021{ 1022 // ook? 1023} 1024 1025SetMonkey::~SetMonkey() 1026{ 1027 //ook... 1028} 1029 1030void SetMonkey::append(UnicodeString &test, UnicodeString &alternate) 1031{ 1032 int32_t size = uset_size(set); 1033 int32_t index = m_rand() % size; 1034 UChar32 ch = uset_charAt(set, index); 1035 UnicodeString str(ch); 1036 1037 test.append(str); 1038 alternate.append(str); // flip case, or some junk? 1039} 1040 1041class StringSetMonkey : public Monkey 1042{ 1043public: 1044 StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData); 1045 ~StringSetMonkey(); 1046 1047 void append(UnicodeString &testCase, UnicodeString &alternate); 1048 1049private: 1050 UnicodeString &generateAlternative(const UnicodeString &testCase, UnicodeString &alternate); 1051 1052 const USet *set; 1053 UCollator *coll; 1054 CollData *collData; 1055}; 1056 1057StringSetMonkey::StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData) 1058: Monkey(), set(theSet), coll(theCollator), collData(theCollData) 1059{ 1060 // ook. 1061} 1062 1063StringSetMonkey::~StringSetMonkey() 1064{ 1065 // ook? 1066} 1067 1068void StringSetMonkey::append(UnicodeString &testCase, UnicodeString &alternate) 1069{ 1070 int32_t itemCount = uset_getItemCount(set), len = 0; 1071 int32_t index = m_rand() % itemCount; 1072 UChar32 rangeStart = 0, rangeEnd = 0; 1073 UChar buffer[16]; 1074 UErrorCode err = U_ZERO_ERROR; 1075 1076 len = uset_getItem(set, index, &rangeStart, &rangeEnd, buffer, 16, &err); 1077 1078 if (len == 0) { 1079 int32_t offset = m_rand() % (rangeEnd - rangeStart + 1); 1080 UChar32 ch = rangeStart + offset; 1081 UnicodeString str(ch); 1082 1083 testCase.append(str); 1084 generateAlternative(str, alternate); 1085 } else if (len > 0) { 1086 // should check that len < 16... 1087 UnicodeString str(buffer, len); 1088 1089 testCase.append(str); 1090 generateAlternative(str, alternate); 1091 } else { 1092 // shouldn't happen... 1093 } 1094} 1095 1096UnicodeString &StringSetMonkey::generateAlternative(const UnicodeString &testCase, UnicodeString &alternate) 1097{ 1098 // find out shortest string for the longest sequence of ces. 1099 // needs to be refined to use dynamic programming, but will be roughly right 1100 UErrorCode status = U_ZERO_ERROR; 1101 CEList ceList(coll, testCase, status); 1102 UnicodeString alt; 1103 int32_t offset = 0; 1104 1105 if (ceList.size() == 0) { 1106 return alternate.append(testCase); 1107 } 1108 1109 while (offset < ceList.size()) { 1110 int32_t ce = ceList.get(offset); 1111 const StringList *strings = collData->getStringList(ce); 1112 1113 if (strings == NULL) { 1114 return alternate.append(testCase); 1115 } 1116 1117 int32_t stringCount = strings->size(); 1118 int32_t tries = 0; 1119 1120 // find random string that generates the same CEList 1121 const CEList *ceList2 = NULL; 1122 const UnicodeString *string = NULL; 1123 UBool matches = FALSE; 1124 1125 do { 1126 int32_t s = m_rand() % stringCount; 1127 1128 if (tries++ > stringCount) { 1129 alternate.append(testCase); 1130 return alternate; 1131 } 1132 1133 string = strings->get(s); 1134 ceList2 = collData->getCEList(string); 1135 matches = ceList.matchesAt(offset, ceList2); 1136 1137 if (! matches) { 1138 collData->freeCEList((CEList *) ceList2); 1139 } 1140 } while (! matches); 1141 1142 alt.append(*string); 1143 offset += ceList2->size(); 1144 collData->freeCEList(ceList2); 1145 } 1146 1147 const CEList altCEs(coll, alt, status); 1148 1149 if (ceList.matchesAt(0, &altCEs)) { 1150 return alternate.append(alt); 1151 } 1152 1153 return alternate.append(testCase); 1154} 1155 1156static void generateTestCase(UCollator *coll, Monkey *monkeys[], int32_t monkeyCount, UnicodeString &testCase, UnicodeString &alternate) 1157{ 1158 int32_t pieces = (m_rand() % 4) + 1; 1159 UErrorCode status = U_ZERO_ERROR; 1160 UBool matches; 1161 1162 do { 1163 testCase.remove(); 1164 alternate.remove(); 1165 monkeys[0]->append(testCase, alternate); 1166 1167 for(int32_t piece = 0; piece < pieces; piece += 1) { 1168 int32_t monkey = m_rand() % monkeyCount; 1169 1170 monkeys[monkey]->append(testCase, alternate); 1171 } 1172 1173 const CEList ceTest(coll, testCase, status); 1174 const CEList ceAlt(coll, alternate, status); 1175 1176 matches = ceTest.matchesAt(0, &ceAlt); 1177 } while (! matches); 1178} 1179 1180static UBool simpleSearch(UCollator *coll, const UnicodeString &target, int32_t offset, const UnicodeString &pattern, int32_t &matchStart, int32_t &matchEnd) 1181{ 1182 UErrorCode status = U_ZERO_ERROR; 1183 OrderList targetOrders(coll, target, offset); 1184 OrderList patternOrders(coll, pattern); 1185 int32_t targetSize = targetOrders.size() - 1; 1186 int32_t patternSize = patternOrders.size() - 1; 1187 UBreakIterator *charBreakIterator = ubrk_open(UBRK_CHARACTER, ucol_getLocaleByType(coll, ULOC_VALID_LOCALE, &status), 1188 target.getBuffer(), target.length(), &status); 1189 1190 if (patternSize == 0) { 1191 // Searching for an empty pattern always fails 1192 matchStart = matchEnd = -1; 1193 ubrk_close(charBreakIterator); 1194 return FALSE; 1195 } 1196 1197 matchStart = matchEnd = -1; 1198 1199 for(int32_t i = 0; i < targetSize; i += 1) { 1200 if (targetOrders.matchesAt(i, patternOrders)) { 1201 int32_t start = targetOrders.getLowOffset(i); 1202 int32_t maxLimit = targetOrders.getLowOffset(i + patternSize); 1203 int32_t minLimit = targetOrders.getLowOffset(i + patternSize - 1); 1204 1205 // if the low and high offsets of the first CE in 1206 // the match are the same, it means that the match 1207 // starts in the middle of an expansion - all but 1208 // the first CE of the expansion will have the offset 1209 // of the following character. 1210 if (start == targetOrders.getHighOffset(i)) { 1211 continue; 1212 } 1213 1214 // Make sure match starts on a grapheme boundary 1215 if (! ubrk_isBoundary(charBreakIterator, start)) { 1216 continue; 1217 } 1218 1219 // If the low and high offsets of the CE after the match 1220 // are the same, it means that the match ends in the middle 1221 // of an expansion sequence. 1222 if (maxLimit == targetOrders.getHighOffset(i + patternSize) && 1223 targetOrders.getOrder(i + patternSize) != UCOL_NULLORDER) { 1224 continue; 1225 } 1226 1227 int32_t mend = maxLimit; 1228 1229 // Find the first grapheme break after the character index 1230 // of the last CE in the match. If it's after character index 1231 // that's after the last CE in the match, use that index 1232 // as the end of the match. 1233 if (minLimit < maxLimit) { 1234 // When the last CE's low index is same with its high index, the CE is likely 1235 // a part of expansion. In this case, the index is located just after the 1236 // character corresponding to the CEs compared above. If the index is right 1237 // at the break boundary, move the position to the next boundary will result 1238 // incorrect match length when there are ignorable characters exist between 1239 // the position and the next character produces CE(s). See ticket#8482. 1240 if (minLimit == targetOrders.getHighOffset(i + patternSize - 1) && ubrk_isBoundary(charBreakIterator, minLimit)) { 1241 mend = minLimit; 1242 } else { 1243 int32_t nba = ubrk_following(charBreakIterator, minLimit); 1244 1245 if (nba >= targetOrders.getHighOffset(i + patternSize - 1)) { 1246 mend = nba; 1247 } 1248 } 1249 } 1250 1251 if (mend > maxLimit) { 1252 continue; 1253 } 1254 1255 if (! ubrk_isBoundary(charBreakIterator, mend)) { 1256 continue; 1257 } 1258 1259 matchStart = start; 1260 matchEnd = mend; 1261 1262 ubrk_close(charBreakIterator); 1263 return TRUE; 1264 } 1265 } 1266 1267 ubrk_close(charBreakIterator); 1268 return FALSE; 1269} 1270 1271#if !UCONFIG_NO_REGULAR_EXPRESSIONS 1272static int32_t getIntParam(UnicodeString name, UnicodeString ¶ms, int32_t defaultVal) { 1273 int32_t val = defaultVal; 1274 1275 name.append(" *= *(-?\\d+)"); 1276 1277 UErrorCode status = U_ZERO_ERROR; 1278 RegexMatcher m(name, params, 0, status); 1279 1280 if (m.find()) { 1281 // The param exists. Convert the string to an int. 1282 char valString[100]; 1283 int32_t paramLength = m.end(1, status) - m.start(1, status); 1284 1285 if (paramLength >= (int32_t)(sizeof(valString)-1)) { 1286 paramLength = (int32_t)(sizeof(valString)-2); 1287 } 1288 1289 params.extract(m.start(1, status), paramLength, valString, sizeof(valString)); 1290 val = uprv_strtol(valString, NULL, 10); 1291 1292 // Delete this parameter from the params string. 1293 m.reset(); 1294 params = m.replaceFirst("", status); 1295 } 1296 1297 //U_ASSERT(U_SUCCESS(status)); 1298 if (! U_SUCCESS(status)) { 1299 val = defaultVal; 1300 } 1301 1302 return val; 1303} 1304#endif 1305 1306#if !UCONFIG_NO_COLLATION 1307int32_t SSearchTest::monkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern, 1308 const char *name, const char *strength, uint32_t seed) 1309{ 1310 UErrorCode status = U_ZERO_ERROR; 1311 int32_t actualStart = -1, actualEnd = -1; 1312 //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length(); 1313 int32_t expectedStart = -1, expectedEnd = -1; 1314 int32_t notFoundCount = 0; 1315 LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), 1316 testCase.getBuffer(), testCase.length(), 1317 coll, 1318 NULL, // the break iterator 1319 &status)); 1320 1321 // **** TODO: find *all* matches, not just first one **** 1322 simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd); 1323 1324 usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status); 1325 1326 if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { 1327 errln("Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" 1328 " strength=%s seed=%d", 1329 name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed); 1330 } 1331 1332 if (expectedStart == -1 && actualStart == -1) { 1333 notFoundCount += 1; 1334 } 1335 1336 // **** TODO: find *all* matches, not just first one **** 1337 simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd); 1338 1339 usearch_setPattern(uss.getAlias(), altPattern.getBuffer(), altPattern.length(), &status); 1340 1341 usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status); 1342 1343 if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { 1344 errln("Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" 1345 " strength=%s seed=%d", 1346 name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed); 1347 } 1348 1349 if (expectedStart == -1 && actualStart == -1) { 1350 notFoundCount += 1; 1351 } 1352 1353 return notFoundCount; 1354} 1355#endif 1356 1357void SSearchTest::monkeyTest(char *params) 1358{ 1359 // ook! 1360 UErrorCode status = U_ZERO_ERROR; 1361 //UCollator *coll = ucol_open(NULL, &status); 1362 UCollator *coll = ucol_openFromShortString("S1", FALSE, NULL, &status); 1363 1364 if (U_FAILURE(status)) { 1365 errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status)); 1366 return; 1367 } 1368 1369 CollData *monkeyData = new CollData(coll, status); 1370 1371 USet *expansions = uset_openEmpty(); 1372 USet *contractions = uset_openEmpty(); 1373 1374 ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status); 1375 1376 U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); 1377 U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); 1378 USet *letters = uset_openPattern(letter_pattern, 39, &status); 1379 SetMonkey letterMonkey(letters); 1380 StringSetMonkey contractionMonkey(contractions, coll, monkeyData); 1381 StringSetMonkey expansionMonkey(expansions, coll, monkeyData); 1382 UnicodeString testCase; 1383 UnicodeString alternate; 1384 UnicodeString pattern, altPattern; 1385 UnicodeString prefix, altPrefix; 1386 UnicodeString suffix, altSuffix; 1387 1388 Monkey *monkeys[] = { 1389 &letterMonkey, 1390 &contractionMonkey, 1391 &expansionMonkey, 1392 &contractionMonkey, 1393 &expansionMonkey, 1394 &contractionMonkey, 1395 &expansionMonkey, 1396 &contractionMonkey, 1397 &expansionMonkey}; 1398 int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]); 1399 // int32_t nonMatchCount = 0; 1400 1401 UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY}; 1402 const char *strengthNames[] = {"primary", "secondary", "tertiary"}; 1403 int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]); 1404 int32_t loopCount = quick? 1000 : 10000; 1405 int32_t firstStrength = 0; 1406 int32_t lastStrength = strengthCount - 1; //*/ 0; 1407 1408 if (params != NULL) { 1409#if !UCONFIG_NO_REGULAR_EXPRESSIONS 1410 UnicodeString p(params); 1411 1412 loopCount = getIntParam("loop", p, loopCount); 1413 m_seed = getIntParam("seed", p, m_seed); 1414 1415 RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status); 1416 if (m.find()) { 1417 UnicodeString breakType = m.group(1, status); 1418 1419 for (int32_t s = 0; s < strengthCount; s += 1) { 1420 if (breakType == strengthNames[s]) { 1421 firstStrength = lastStrength = s; 1422 break; 1423 } 1424 } 1425 1426 m.reset(); 1427 p = m.replaceFirst("", status); 1428 } 1429 1430 if (RegexMatcher("\\S", p, 0, status).find()) { 1431 // Each option is stripped out of the option string as it is processed. 1432 // All options have been checked. The option string should have been completely emptied.. 1433 char buf[100]; 1434 p.extract(buf, sizeof(buf), NULL, status); 1435 buf[sizeof(buf)-1] = 0; 1436 errln("Unrecognized or extra parameter: %s\n", buf); 1437 return; 1438 } 1439#else 1440 infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters."); 1441#endif 1442 } 1443 1444 for(int32_t s = firstStrength; s <= lastStrength; s += 1) { 1445 int32_t notFoundCount = 0; 1446 1447 logln("Setting strength to %s.", strengthNames[s]); 1448 ucol_setStrength(coll, strengths[s]); 1449 1450 // TODO: try alternate prefix and suffix too? 1451 // TODO: alterntaes are only equal at primary strength. Is this OK? 1452 for(int32_t t = 0; t < loopCount; t += 1) { 1453 uint32_t seed = m_seed; 1454 // int32_t nmc = 0; 1455 1456 generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern); 1457 generateTestCase(coll, monkeys, monkeyCount, prefix, altPrefix); 1458 generateTestCase(coll, monkeys, monkeyCount, suffix, altSuffix); 1459 1460 // pattern 1461 notFoundCount += monkeyTestCase(coll, pattern, pattern, altPattern, "pattern", strengthNames[s], seed); 1462 1463 testCase.remove(); 1464 testCase.append(prefix); 1465 testCase.append(/*alt*/pattern); 1466 1467 // prefix + pattern 1468 notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern", strengthNames[s], seed); 1469 1470 testCase.append(suffix); 1471 1472 // prefix + pattern + suffix 1473 notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern + suffix", strengthNames[s], seed); 1474 1475 testCase.remove(); 1476 testCase.append(pattern); 1477 testCase.append(suffix); 1478 1479 // pattern + suffix 1480 notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "pattern + suffix", strengthNames[s], seed); 1481 } 1482 1483 logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount); 1484 } 1485 1486 uset_close(contractions); 1487 uset_close(expansions); 1488 uset_close(letters); 1489 delete monkeyData; 1490 1491 ucol_close(coll); 1492} 1493 1494#endif 1495 1496#endif 1497